View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3594_low_33 (Length: 246)
Name: NF3594_low_33
Description: NF3594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3594_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 16 - 197
Target Start/End: Complemental strand, 50136942 - 50136755
Alignment:
| Q |
16 |
ggttcatttgattcgagctattgagttgaactaagtcaaactaagttagttgtgagtttgaatcgagttgaattcatgctcnnnnnnngttgttgttgt- |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50136942 |
ggttcatttgattcgagctattgagttgaaccgagtcaaattaagttagttgtgagtttgaatcgagttgaattcatgctcaaaaaaagttgttgttgtt |
50136843 |
T |
 |
| Q |
115 |
-----gtcacagttggatttatgttgttgaaattgtgannnnnnnncctaaagaaattgttgtttttaattatgtggattttatcctt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50136842 |
gttgcgtcacagttggatttatgttgttgaaattgtgattttttttcctaaagaaattgttgtttttaattatgtggattttatcctt |
50136755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University