View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3594_low_37 (Length: 230)
Name: NF3594_low_37
Description: NF3594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3594_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 38040087 - 38039869
Alignment:
| Q |
1 |
tgtcaccatcggtggttgtttctcgtaggtatcaaatatttattatttcgataaaaactgctatggttttaattttaacataaaaagattctgctggttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38040087 |
tgtcaccatcggtggttgtttctcgtaggtatcaaatatttattatttcgataaaa-ctgctatggttttaattttaacataaaaagatgctgctggttt |
38039989 |
T |
|
| Q |
101 |
tgatgtgataaatttacctatgtacttttagaactacttctattaattatttccatatactagtacattgctattgattatttttgtaaggtaagaataa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38039988 |
tgatgtgataaatttacctatgtacttttagaactacttctattaattatttccatatagtagtacattactattgattatttttgtaaggtaagaataa |
38039889 |
T |
|
| Q |
201 |
tgtcattgacccgaattcat |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38039888 |
tgtcattgacccgaattcat |
38039869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University