View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3594_low_39 (Length: 215)

Name: NF3594_low_39
Description: NF3594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3594_low_39
NF3594_low_39
[»] chr4 (1 HSPs)
chr4 (13-81)||(47415121-47415189)
[»] chr1 (1 HSPs)
chr1 (16-74)||(37249015-37249073)


Alignment Details
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 13 - 81
Target Start/End: Complemental strand, 47415189 - 47415121
Alignment:
13 agcagagaactcgtttttctcatactccagtttctcgatgaagagaaattcaaggagtctgttcatagg 81  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47415189 agcagagaactcgtttttctcatactccagtttctcgatgaagagaaattcaaggagtctgttcatagg 47415121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 74
Target Start/End: Original strand, 37249015 - 37249073
Alignment:
16 agagaactcgtttttctcatactccagtttctcgatgaagagaaattcaaggagtctgt 74  Q
    |||||| | |||||||||||||| |||||||| ||||| ||||| |||||||| |||||    
37249015 agagaattggtttttctcatacttcagtttcttgatgaggagaagttcaaggaatctgt 37249073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University