View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3595_low_7 (Length: 254)
Name: NF3595_low_7
Description: NF3595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3595_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 31705028 - 31705169
Alignment:
| Q |
1 |
ctcttatcaaaataacaatcttcataattctctaaagctaacagtggggttggtttactttattgatccaagtagctagacattgttcaccaacttttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31705028 |
ctcttatcaaaataacaatcttcataattctctaaagctaacagtggggttggtttactttattgatccaagtagctagacattgttcatcaacttttgt |
31705127 |
T |
|
| Q |
101 |
agatggtatgcatgtaaatttataagatttaagttttaaatt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31705128 |
agatggtatgcatgtaaatttataagatttaagttttaaatt |
31705169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University