View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3596_low_11 (Length: 240)
Name: NF3596_low_11
Description: NF3596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3596_low_11 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 23830969 - 23830748
Alignment:
| Q |
18 |
tatgaaaggtaaaggggacgaaggaaggtgagtatggtgattcatgcatgacattcattgtatgacatgttgtgggaactggtttaactgtaatggaccc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23830969 |
tatgaaaggtaaaggggacgaaggaaggtgagtatggtgattcatgcatgacattcattgtatgacatgttgtgggaactggtttaactgtaatggaccc |
23830870 |
T |
 |
| Q |
118 |
ccttttgttttgttttgattggacaaaatccttaatannnnnnnngcaaagttttctagtccattagattttactgttaacatccctacatttggtttca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23830869 |
ccttttgttttgttttgattggacaaaatccttaata-tttttttgcaaagttttctagtccattagattttactgttaacatcccgacatttggtttca |
23830771 |
T |
 |
| Q |
218 |
gatagcttctcgtactataagtt |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
23830770 |
gatagcttctcgtactataagtt |
23830748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 59
Target Start/End: Complemental strand, 23817416 - 23817378
Alignment:
| Q |
21 |
gaaaggtaaaggggacgaaggaaggtgagtatggtgatt |
59 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
23817416 |
gaaaggtgaatgggacgaaggaaggtgagtatggtgatt |
23817378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 67
Target Start/End: Complemental strand, 23826874 - 23826842
Alignment:
| Q |
35 |
acgaaggaaggtgagtatggtgattcatgcatg |
67 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
23826874 |
acgaaggaaagtgagtatggtgattcatgcatg |
23826842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University