View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3597_high_13 (Length: 256)
Name: NF3597_high_13
Description: NF3597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3597_high_13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 6 - 256
Target Start/End: Complemental strand, 37192645 - 37192395
Alignment:
| Q |
6 |
agaagcataggtttgtcagttttttgacctcggcgctgctgaataacatccaatcctgtgacattgttgaatattacaaaataaacctagaaataaagta |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37192645 |
agaagtataggtttgtcagttttttgacctcggcgctgctgaataacatccaatcctgtgacattgttgaatattacaaaataaacctagaaataaagta |
37192546 |
T |
 |
| Q |
106 |
ttcaaggttaccttataataaatgctagcagagtattgtagtcttttgctatagttgatttaactcttgcttcaagagggaaaaaacaatactgaactta |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37192545 |
ttcaaggttaccttataataaatgctagcagagtattgtagtcttctgctagagttgatttaactcttgcttcaagagggaaaaaacaatactgaactta |
37192446 |
T |
 |
| Q |
206 |
taatgaatgctagattgctagcaaagaattattgtcgtttctacaaagttt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37192445 |
taatgaatgctagattgctagcaaagaattattgtcgtttctacaaagttt |
37192395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University