View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3597_high_22 (Length: 211)
Name: NF3597_high_22
Description: NF3597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3597_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 4 - 193
Target Start/End: Complemental strand, 35628868 - 35628679
Alignment:
| Q |
4 |
tgcacatctaatggtataaagttagttggtgactgctttatgttgtgctacgtatgtggaattaaatctaaatgtctatagtttccaatttttatgaaag |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
35628868 |
tgcacatctaatggtataaagttagttggtgactgctttatgctgtgctatgtatgtggaattaaatctaaatttctatagtttccaatttttattaaag |
35628769 |
T |
 |
| Q |
104 |
gagtttgtggttatgtaatttgatgtgaatgaccttgaatgaataaatacttactcttggtcattgaataatctgtcacatatgtgaata |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35628768 |
gagtttgtggttatgtaatttgatgtgaatgaccttaaatgaataaatacttactcttggtcattgaataatctgtcacatatgtgaata |
35628679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University