View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3597_low_11 (Length: 321)
Name: NF3597_low_11
Description: NF3597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3597_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 47 - 155
Target Start/End: Original strand, 39602713 - 39602822
Alignment:
| Q |
47 |
cgatgtaaaaattgatggcaa-tgacgatggtgcagtgcctagccagcgatgacggtcttgaaaattcaacggggacaatggtgaaaaagaaaactgaac |
145 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39602713 |
cgatgtaaaaattgatggcaactgacgatggtgcagtgcctagccagcgatgacggtcttgaaaattcaatggggacaatggtgaaaaagaaaactgaac |
39602812 |
T |
|
| Q |
146 |
tgtctcttca |
155 |
Q |
| |
|
|||||||||| |
|
|
| T |
39602813 |
tgtctcttca |
39602822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 48
Target Start/End: Original strand, 39602651 - 39602679
Alignment:
| Q |
20 |
agtgacgaagtgaggacccgaaagtggcg |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39602651 |
agtgacgaagtgaggacccgaaagtggcg |
39602679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University