View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3597_low_16 (Length: 247)
Name: NF3597_low_16
Description: NF3597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3597_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 10901833 - 10901601
Alignment:
| Q |
1 |
atggtcataaaataccaaaaaatgcgatgattaattttcctgtggccgaatttggatgggaccctagtgtgtgggaaaatcctatggaatttaagcctga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10901833 |
atggtcataaaataccaaaaaatgcgatgattaattttcctgtggccgaatttggatgggaccctagtgtgtgggaaaatcctatggagtttaagcctga |
10901734 |
T |
|
| Q |
101 |
aagatttttgggtgaagaaaatgctaattttgatctaaaagggattaaagagattaaaatgatgccttttggcgcaggcagaagggtttgtccagcaatt |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10901733 |
aagatttttgagtgaagaaaatgctaattttgatctaaaagggatcaaagagattaaaatgatgccttttggcgcaggcagaagggtttgtccagcaatt |
10901634 |
T |
|
| Q |
201 |
aatattgcaacatttcatcttgggtactttgtg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10901633 |
aatattgcaacatttcatcttgggtactttgtg |
10901601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University