View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3597_low_21 (Length: 235)
Name: NF3597_low_21
Description: NF3597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3597_low_21 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 235
Target Start/End: Complemental strand, 41096407 - 41096189
Alignment:
| Q |
17 |
attagattgcttgctccacacaagtcagcagataaacgcggtttatctaattgcaaattcgcataacagccaagcagttatcttaggttgcgaccttagt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41096407 |
attagattgcttgctccacacaagtcagcagataaacgcggtttctctaattgcaaattcgcataacagccaagcagttatcttaggttgcgaccttagt |
41096308 |
T |
|
| Q |
117 |
tactagttggttgtataatcaagtggtaagagacttgggcaccttaagcaagtggtcaaccgagttcgatccttgactattgtgtatatagaatatccac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41096307 |
tactagttggttgtataatcaagtggtaagagacttgggaaccttaagcaagtggtcaaccgagttcgatccttgactattgtgtatatagaatatccac |
41096208 |
T |
|
| Q |
217 |
tcggaatgaaaaaacccat |
235 |
Q |
| |
|
|||| |||||||||||||| |
|
|
| T |
41096207 |
tcgggatgaaaaaacccat |
41096189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University