View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3597_low_3 (Length: 643)
Name: NF3597_low_3
Description: NF3597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3597_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 41; Significance: 0.00000000000006; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 507 - 551
Target Start/End: Original strand, 38246529 - 38246573
Alignment:
| Q |
507 |
acataagttttatgaactgcaacacaagttgatctctagattcat |
551 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38246529 |
acataagttttatgaactgcaacacaagttgatctctagcttcat |
38246573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 507 - 551
Target Start/End: Original strand, 38262799 - 38262843
Alignment:
| Q |
507 |
acataagttttatgaactgcaacacaagttgatctctagattcat |
551 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38262799 |
acataagttttatgaactgcaacacaagttgatctctagcttcat |
38262843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 598 - 626
Target Start/End: Original strand, 38246814 - 38246842
Alignment:
| Q |
598 |
aatgcttcaatatcgttattcacttcttc |
626 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38246814 |
aatgcttcaatatcgttattcacttcttc |
38246842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 598 - 626
Target Start/End: Original strand, 38263084 - 38263112
Alignment:
| Q |
598 |
aatgcttcaatatcgttattcacttcttc |
626 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38263084 |
aatgcttcaatatcgttattcacttcttc |
38263112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University