View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3598_high_10 (Length: 357)
Name: NF3598_high_10
Description: NF3598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3598_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 349
Target Start/End: Original strand, 2018722 - 2019070
Alignment:
| Q |
1 |
gaattcaggaactcgatctctgcttggtcactttaatcgaattgccttttggcttctacacttgcaataatcttgtcacacttaagctagaaaatgttac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2018722 |
gaattcaggaactcgatctctgcttggtcactttaatcgaattgccttttggcttctacacttgcaataatcttgtcacacttaagctagacaatgttac |
2018821 |
T |
|
| Q |
101 |
tttcaaagatggctcttcctatatcaattttccattactcaaatccctaaatttgaacgacgtcgtctttggaaaccgtgctaacatgttggacnnnnnn |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
2018822 |
tttcaaagatggctcttcctatatcaattttccattactcaaatcccttaatttgaacgacgtcgtctttggaaatcgtgctaacatgtttgactttttt |
2018921 |
T |
|
| Q |
201 |
ngcggatgtcccaatgttgaagatgtagaagtgacttcactatcaatagttaatagtcgcattcctcagccaccagaagagggggttgaagccttaccaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018922 |
tgcggatgtcccaatgttgaagatgtagaagtgacatcactatcaatagttaatagtcgcattcctcagccaccagaagagggggttgaagccttaccaa |
2019021 |
T |
|
| Q |
301 |
agttggtcagagcaaaaatttcagaattatatagcatgttacctttgct |
349 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2019022 |
agttggtcagagcaaaaatttcagaattacatagcatgttacctttgct |
2019070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University