View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3598_high_16 (Length: 321)
Name: NF3598_high_16
Description: NF3598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3598_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 16 - 90
Target Start/End: Complemental strand, 7096796 - 7096722
Alignment:
| Q |
16 |
cagtcttggtcatcttattcaagctcatatacgaatttttccctttgttgcccaatggtcgaatgcgaagcaact |
90 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7096796 |
cagtcttggtcatcttattcaagctcatacacagatttttccctttgttgcccaatggtcgaatgcgaagcaact |
7096722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 16 - 85
Target Start/End: Original strand, 8799548 - 8799617
Alignment:
| Q |
16 |
cagtcttggtcatcttattcaagctcatatacgaatttttccctttgttgcccaatggtcgaatgcgaag |
85 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8799548 |
cagtcttggtcatcttattcaagctcatacacagatttttccctttgttgcccaatggtcgaatgcgaag |
8799617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University