View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3598_high_18 (Length: 283)
Name: NF3598_high_18
Description: NF3598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3598_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 3357579 - 3357304
Alignment:
| Q |
1 |
tgttggttggttagttataatattggttgagagcactctattttggagggaccatgggttggatggtgtaccttttttgttcggttcgatagattatatg |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3357579 |
tgttggttgattagttataatattggttgagagcactctattttggagggaccatgggttggatggtgtaccttttttgttcggttcgatagattatatg |
3357480 |
T |
|
| Q |
101 |
agttagctgagaacaaaatgaagattatatggagtgaatagagaggcgtggaagtgacgacataagctctttgattgggaagaggagttagtgggggagt |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3357479 |
agttagctaagaacaaaatgaagattatatggagtcaatggagaggcgtggaagtgacggcataagctctttgattgggaagaggagttagtgagggagt |
3357380 |
T |
|
| Q |
201 |
gtattgagttgttaacttctagtgtcttgcaggttgatgtggagggttagtgggtttgaaagcttcattcatttca |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3357379 |
gtattgagttgttaacttctagtgtcttgcaggttgatgtggagggttagtgggtttgaaagcttcattcttttca |
3357304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 62 - 121
Target Start/End: Original strand, 14956565 - 14956625
Alignment:
| Q |
62 |
gatggtgtacctttt-ttgttcggttcgatagattatatgagttagctgagaacaaaatga |
121 |
Q |
| |
|
||||||||||||||| ||||| |||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
14956565 |
gatggtgtaccttttattgttaggttatgtagattatatgagttaactgagaacaaaatga |
14956625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University