View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3598_low_16 (Length: 321)

Name: NF3598_low_16
Description: NF3598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3598_low_16
NF3598_low_16
[»] chr6 (2 HSPs)
chr6 (16-90)||(7096722-7096796)
chr6 (16-85)||(8799548-8799617)


Alignment Details
Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 16 - 90
Target Start/End: Complemental strand, 7096796 - 7096722
Alignment:
16 cagtcttggtcatcttattcaagctcatatacgaatttttccctttgttgcccaatggtcgaatgcgaagcaact 90  Q
    ||||||||||||||||||||||||||||| ||  |||||||||||||||||||||||||||||||||||||||||    
7096796 cagtcttggtcatcttattcaagctcatacacagatttttccctttgttgcccaatggtcgaatgcgaagcaact 7096722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 16 - 85
Target Start/End: Original strand, 8799548 - 8799617
Alignment:
16 cagtcttggtcatcttattcaagctcatatacgaatttttccctttgttgcccaatggtcgaatgcgaag 85  Q
    ||||||||||||||||||||||||||||| ||  ||||||||||||||||||||||||||||||||||||    
8799548 cagtcttggtcatcttattcaagctcatacacagatttttccctttgttgcccaatggtcgaatgcgaag 8799617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University