View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3598_low_18 (Length: 283)

Name: NF3598_low_18
Description: NF3598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3598_low_18
NF3598_low_18
[»] chr1 (1 HSPs)
chr1 (1-276)||(3357304-3357579)
[»] chr4 (1 HSPs)
chr4 (62-121)||(14956565-14956625)


Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 3357579 - 3357304
Alignment:
1 tgttggttggttagttataatattggttgagagcactctattttggagggaccatgggttggatggtgtaccttttttgttcggttcgatagattatatg 100  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3357579 tgttggttgattagttataatattggttgagagcactctattttggagggaccatgggttggatggtgtaccttttttgttcggttcgatagattatatg 3357480  T
101 agttagctgagaacaaaatgaagattatatggagtgaatagagaggcgtggaagtgacgacataagctctttgattgggaagaggagttagtgggggagt 200  Q
    |||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||    
3357479 agttagctaagaacaaaatgaagattatatggagtcaatggagaggcgtggaagtgacggcataagctctttgattgggaagaggagttagtgagggagt 3357380  T
201 gtattgagttgttaacttctagtgtcttgcaggttgatgtggagggttagtgggtttgaaagcttcattcatttca 276  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
3357379 gtattgagttgttaacttctagtgtcttgcaggttgatgtggagggttagtgggtttgaaagcttcattcttttca 3357304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 62 - 121
Target Start/End: Original strand, 14956565 - 14956625
Alignment:
62 gatggtgtacctttt-ttgttcggttcgatagattatatgagttagctgagaacaaaatga 121  Q
    ||||||||||||||| ||||| ||||   |||||||||||||||| |||||||||||||||    
14956565 gatggtgtaccttttattgttaggttatgtagattatatgagttaactgagaacaaaatga 14956625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University