View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3598_low_19 (Length: 279)
Name: NF3598_low_19
Description: NF3598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3598_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 15357618 - 15357895
Alignment:
| Q |
1 |
ttgcttcacctcaaaccccttcaagggttgtgtaccactttgtatgcgcaaccccgatgtgttctctagttttcgccagctttgttctttcacgtttcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15357618 |
ttgcttcacctcaaaccccttcaagggttgtgtaccactttgtatgcgcaaccccgataagt-ctctagttttcgccagctttgttctttcacgtttcag |
15357716 |
T |
 |
| Q |
101 |
tggtggc--------------ctattgttgatattttcaacacatgggttagttcccaatgttttgtggtcgctggatcgggtttcgttttgctcgttat |
186 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15357717 |
tggtggcttatggttcttaacctattgttgatattttcaacacatgggttagttcccaatgtattgtggtcgctggatcgggtttcgttttgctcgttat |
15357816 |
T |
 |
| Q |
187 |
ggtttgaagtgattgtctcaataaccctaagagtatgttggtgttggtgagatttacgaattggattgatttttgtgcc |
265 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15357817 |
ggtttgatgtgattgtctcaataaccctaagagtatgttggtgttcgtgagatttacgaattggattgatttttgtgcc |
15357895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University