View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3598_low_24 (Length: 241)
Name: NF3598_low_24
Description: NF3598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3598_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 3496196 - 3496408
Alignment:
| Q |
1 |
ttgccctgacctcttgagcatttgatcctacaagtagcctacactttatcatgtctagaccctgcaatcatacaaaacatagttgttttgagcgctgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3496196 |
ttgccctgacctcttgagcatttgatcctacaagtagcctgcactttatcatgtctagaccctgcaatcatacaaaacatagttgttttgagcgctgaaa |
3496295 |
T |
|
| Q |
101 |
gcagcataaaaaagccatttccatatgcattaaaacattacactaagccaaaaagctaaaatgtgaagttaatgtcagacaatttaacaagagatgtacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3496296 |
gcagcataaaaaagccatttccatatgcattaaaacattacactaagccaaaaagctaaaatgtaaagttaatgtcagacaatttaacaagagatgtacc |
3496395 |
T |
|
| Q |
201 |
atatgaaagccac |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3496396 |
atatgaaagccac |
3496408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 3 - 72
Target Start/End: Original strand, 35564204 - 35564273
Alignment:
| Q |
3 |
gccctgacctcttgagcatttgatcctacaagtagcctacactttatcatgtctagaccctgcaatcata |
72 |
Q |
| |
|
||||||||||| || ||||| || ||| | |||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
35564204 |
gccctgacctcctgcgcattagacccttccagtagcctgcactttatcctgtctagactctgcaatcata |
35564273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University