View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3598_low_30 (Length: 229)
Name: NF3598_low_30
Description: NF3598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3598_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 213
Target Start/End: Original strand, 40941927 - 40942125
Alignment:
| Q |
15 |
cctgtgctttcatatcaacaatatgtttcaaagttataatcttatgaaattatttcaaaatatatcatcatcacatcatgtgcttaaaaatgaaactctg |
114 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40941927 |
cctgtgctgtcatatcaacaatatgtttcaaagttataatcttatgaaattatttcaaaatatatcatcatcacatcatgtgcttaaaaatgaaactctg |
40942026 |
T |
 |
| Q |
115 |
gggacaatatattgcttcaggctattgttttgaaggtactgcttatatttacaggcacttaaaaagtttggtgtagaaaaatttgaccctacaaatgag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40942027 |
gggacaatatattgcttcaggctattgttttgaaggtaatgcttatatttacaggcacttaaaaagtttggtgtagaaaaatttgaccctacaaatgag |
40942125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University