View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3598_low_33 (Length: 215)
Name: NF3598_low_33
Description: NF3598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3598_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 10902171 - 10902384
Alignment:
| Q |
1 |
gatagtagccatcaataaaactccatcagcatcagattcatcttcattgtaggaaaactgttcttcatctgctctatctcttgcaaccttcttagacttg |
100 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10902171 |
gatagtagccattaataaaactccaccagcatcagattcatcttcattgtaggaaaactgttcttcatctgctctatctcttgcaaccttcttagacttg |
10902270 |
T |
|
| Q |
101 |
gattcagctgcaaattgacctcgc--------attatagcattgaatgtatttcttctcaactttctttttcttccctttgtaattattggacctgcctt |
192 |
Q |
| |
|
| ||||||||||| ||||| ||| ||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10902271 |
aagtcagctgcaaaatgaccccgcttctcacagttatatcattgaatgtatttcttctcaactttctttttctaccctttgtaattattggacctgcctt |
10902370 |
T |
|
| Q |
193 |
ctgcactttcttct |
206 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
10902371 |
ctacactttcttct |
10902384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 20694222 - 20694135
Alignment:
| Q |
1 |
gatagtagccatcaataaaactccatcagcatcagattcatcttcattgtaggaaaactgttcttcatctgctctatctcttgcaacc |
88 |
Q |
| |
|
||||||||||||| || |||| |||| || ||| ||||||||||||||||| ||| || |||||||||||||||| ||||||||| |
|
|
| T |
20694222 |
gatagtagccatctgtagaacttcatctgcgtcaaattcatcttcattgtagccaaaatgcacttcatctgctctatcccttgcaacc |
20694135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University