View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3599_low_16 (Length: 295)
Name: NF3599_low_16
Description: NF3599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3599_low_16 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 18 - 295
Target Start/End: Complemental strand, 38868857 - 38868580
Alignment:
| Q |
18 |
gtttacatacatctatgatactcaagactattatgccctaaataatgaacccattatttgtctgagcaaggtgctttgtgaatgtggcacataataacaa |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38868857 |
gtttacatacatatatgatactcaagactattatgccctaaacaatgaacccattatttgtctgagcaaggtgctttgtgaatgtggcacataataacaa |
38868758 |
T |
 |
| Q |
118 |
gcttatatagatcctttttcgtcttttaatgcattgtgatcataaagacaagatcatgtgatgtgaagcagctagcatgttgtgcctctttcggtggcat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38868757 |
gcttatatagatcctttttcgtcttttaatgcattgtgatcataaagacaagatcatgtgatgtgaagcagctagcatgttgtgcctctttcggtggcat |
38868658 |
T |
 |
| Q |
218 |
ctcgtgaatacttcctataaaattggatggtccagaacatgagatttatccattttactactaactgattattgagac |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38868657 |
ctcgtgaatacttcctataaaattggatggtccagaacatgagatttatccattttactactaactgattattgagac |
38868580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 194 - 232
Target Start/End: Complemental strand, 38869102 - 38869064
Alignment:
| Q |
194 |
atgttgtgcctctttcggtggcatctcgtgaatacttcc |
232 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38869102 |
atgttgtgcctctttcggtggcttctcgtgaatacttcc |
38869064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University