View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3599_low_22 (Length: 221)
Name: NF3599_low_22
Description: NF3599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3599_low_22 |
 |  |
|
| [»] chr3 (7 HSPs) |
 |  |
|
| [»] scaffold0596 (1 HSPs) |
 |  |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 17682130 - 17682350
Alignment:
| Q |
1 |
catacatgaagaaaatttcaatctctcccatgtcttttccactttcaatgttgtcttttctcctcccactccccttcaccaatgctctcgattccgacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17682130 |
catacatgaagaaaatttcaatctctcccatgtcttttccactttcaatgttgtcttttctcctcccattccccttcaccaatgctctcgattccgacat |
17682229 |
T |
 |
| Q |
101 |
cacctttgctgttgtcgactttcccaccaccgtctgcggcatcgtatcagccagacaagcaaaaagaaccgcacaaagagaaagaagccatggaaatttg |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17682230 |
cacctttgccgttgtcgactttcccaccaccgtctgcggcatcgtatcagccagacaagcaaaaagaaccgcacaaagagaaagaagccatggaaatttg |
17682329 |
T |
 |
| Q |
201 |
caatctcgattggaagctccc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
17682330 |
caatctcgattggaagctccc |
17682350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 19766372 - 19766547
Alignment:
| Q |
1 |
catacatgaagaaaatttcaatctctcccatgtcttttccactttcaatgttgtcttttctcctcccactccccttcaccaatgctctcgattccgacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19766372 |
catacatgaagaaaatttcaatctctcccatgtcttttccactttcacagttgtcttttctcctcccactccccttcaccaatgctctagattccgacat |
19766471 |
T |
 |
| Q |
101 |
cacctttgctgttgtcgactttcccaccaccgtctgcggcatcgtatcagccagacaagcaaaaagaaccgcacaa |
176 |
Q |
| |
|
|||||| || ||||||||||| ||| ||||||| ||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19766472 |
caccttcgccgttgtcgacttccccgccaccgtatgcatcatcgtatcagctagacaagcaaaaagaaccgcacaa |
19766547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 175 - 220
Target Start/End: Original strand, 19766578 - 19766623
Alignment:
| Q |
175 |
aaagagaaagaagccatggaaatttgcaatctcgattggaagctcc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19766578 |
aaagagaaagaagccatggaaatttgcaatctcgattggaagctcc |
19766623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 72 - 117
Target Start/End: Complemental strand, 19881787 - 19881742
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctttgctgttgtcg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
19881787 |
cccttcaccaatgctctcgattccgacatcaccttcgccgttgtcg |
19881742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 72 - 106
Target Start/End: Original strand, 37982797 - 37982831
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37982797 |
cccttcaccaatgctctcgattccgacatcacctt |
37982831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 72 - 103
Target Start/End: Complemental strand, 53972962 - 53972931
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcac |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
53972962 |
cccttcaccaatgctctcgattccgacatcac |
53972931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 72 - 117
Target Start/End: Original strand, 31685508 - 31685553
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctttgctgttgtcg |
117 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||| || ||||||| |
|
|
| T |
31685508 |
cccttcaccaatgatatcgattccgacatcaccttcgccgttgtcg |
31685553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 32277372 - 32277526
Alignment:
| Q |
1 |
catacatgaagaaaatttcaatctctcccatgtcttttccactttcaatgttgtcttttctcctcccactccccttcaccaatgctctcgattccgacat |
100 |
Q |
| |
|
||||||||||| |||||| ||| | |||||||||||||||||||||| ||| |||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
32277372 |
catacatgaaggaaattttaatttgtcccatgtcttttccactttcacctttgccttttctcctcccactccccttcaccgattctctcgattccgacat |
32277471 |
T |
 |
| Q |
101 |
cacctttgctgttgtcgactt----tcccaccaccgtctgcggcatcgtatcagc |
151 |
Q |
| |
|
|| | | || ||||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
32277472 |
catcctcgccgttgtcgacttccccgcccgccaccatctgcggcatcgtatcagc |
32277526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 72 - 115
Target Start/End: Complemental strand, 18354989 - 18354946
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctttgctgttgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18354989 |
cccttcaccaatgctctcgattccgacatcaccttcgctgttgt |
18354946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 72 - 117
Target Start/End: Complemental strand, 23348656 - 23348611
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctttgctgttgtcg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
23348656 |
cccttcaccaatgctctcgattccgacatcaccttcgccgttgtcg |
23348611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 72 - 106
Target Start/End: Original strand, 12742133 - 12742167
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
12742133 |
cccttcaccaatgctctcgattccgacatcacctt |
12742167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 72 - 117
Target Start/End: Complemental strand, 14677698 - 14677653
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctttgctgttgtcg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
14677698 |
cccttcaccaatgctctcgattccgacatcaccttcgccgttgtcg |
14677653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 72 - 117
Target Start/End: Complemental strand, 31100548 - 31100503
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctttgctgttgtcg |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| || ||||||| |
|
|
| T |
31100548 |
cccttcaccaatgctctcgattccaacatcaccttcgccgttgtcg |
31100503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 72 - 117
Target Start/End: Original strand, 5658201 - 5658246
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctttgctgttgtcg |
117 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||| || ||||||| |
|
|
| T |
5658201 |
cccttcaccaatgctcttgattccaacatcaccttcgccgttgtcg |
5658246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 72 - 117
Target Start/End: Original strand, 1262534 - 1262579
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctttgctgttgtcg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
1262534 |
cccttcaccaatgctctcgattccgacatcaccttcgccgttgtcg |
1262579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 72 - 117
Target Start/End: Complemental strand, 43071058 - 43071013
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctttgctgttgtcg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
43071058 |
cccttcaccaatgctctcgattccgacatcaccttcgccgttgtcg |
43071013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 72 - 117
Target Start/End: Complemental strand, 48849458 - 48849413
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctttgctgttgtcg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
48849458 |
cccttcaccaatgctctcgattccgacatcaccttcgccgttgtcg |
48849413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 72 - 117
Target Start/End: Complemental strand, 7473165 - 7473120
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctttgctgttgtcg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
7473165 |
cccttcaccaatgctctcgattccgacatcaccttcgccgttgtcg |
7473120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 72 - 117
Target Start/End: Complemental strand, 30442222 - 30442177
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctttgctgttgtcg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
30442222 |
cccttcaccaatgctctcgattccgacatcaccttggccgttgtcg |
30442177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 72 - 106
Target Start/End: Original strand, 9044247 - 9044281
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctt |
106 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
9044247 |
cccttcaccaatgctctcgatttcgacatcacctt |
9044281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000008; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 72 - 106
Target Start/End: Original strand, 10092917 - 10092951
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
10092917 |
cccttcaccaatgctctcgattccgacatcacctt |
10092951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 131 - 176
Target Start/End: Original strand, 10092961 - 10093006
Alignment:
| Q |
131 |
cgtctgcggcatcgtatcagccagacaagcaaaaagaaccgcacaa |
176 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
10092961 |
cgtctgcggcatcgtatcagccaggcaaacaaaaagaacagcacaa |
10093006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 72 - 106
Target Start/End: Complemental strand, 33045122 - 33045088
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctt |
106 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
33045122 |
cccttcaccaatgctctcgattccaacatcacctt |
33045088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 207
Target Start/End: Complemental strand, 15434371 - 15434339
Alignment:
| Q |
175 |
aaagagaaagaagccatggaaatttgcaatctc |
207 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
15434371 |
aaagagaaataagccatggaaatttgcaatctc |
15434339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0596 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0596
Description:
Target: scaffold0596; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 72 - 117
Target Start/End: Original strand, 1099 - 1144
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctttgctgttgtcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || || ||||||| |
|
|
| T |
1099 |
cccttcaccaatgctctcgattccgacatcactttcgccgttgtcg |
1144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 72 - 117
Target Start/End: Complemental strand, 11310 - 11265
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctttgctgttgtcg |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| || ||||||| |
|
|
| T |
11310 |
cccttcaccaatgctctcgaatccgacatcaccttcgccgttgtcg |
11265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 6 - 47
Target Start/End: Original strand, 50975557 - 50975598
Alignment:
| Q |
6 |
atgaagaaaatttcaatctctcccatgtcttttccactttca |
47 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
50975557 |
atgaagaaaatttcactctcttccatgtcttttccactttca |
50975598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 116
Target Start/End: Complemental strand, 29863037 - 29862993
Alignment:
| Q |
72 |
cccttcaccaatgctctcgattccgacatcacctttgctgttgtc |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||| |||||| |
|
|
| T |
29863037 |
cccttcaccgatgctctcgattccgacatcacttttgccgttgtc |
29862993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 22292362 - 22292316
Alignment:
| Q |
175 |
aaagagaaagaagccatggaaatttgcaatctcgattggaagctccc |
221 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| | |||| |||||| |
|
|
| T |
22292362 |
aaagagaaataagccatggaaatttgcaatctcaagtggaggctccc |
22292316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 6 - 47
Target Start/End: Complemental strand, 37618764 - 37618723
Alignment:
| Q |
6 |
atgaagaaaatttcaatctctcccatgtcttttccactttca |
47 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||| ||||||| |
|
|
| T |
37618764 |
atgaagaaaatttcactctcttccatgtcttttctactttca |
37618723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 29862991 - 29862955
Alignment:
| Q |
133 |
tctgcggcatcgtatcagccagacaagcaaaaagaac |
169 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
29862991 |
tctgcggcatcgtatcagccaggcaaacaaaaagaac |
29862955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 32963 - 32994
Alignment:
| Q |
1 |
catacatgaagaaaatttcaatctctcccatg |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32963 |
catacatgaagaaaatttcaatctctcccatg |
32994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University