View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3599_low_7 (Length: 329)
Name: NF3599_low_7
Description: NF3599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3599_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 14 - 143
Target Start/End: Original strand, 1189548 - 1189679
Alignment:
| Q |
14 |
aatacaggggtcacttttattcccatggattgatacgatatttttaatggataatagagtatcaata--nnnnnnnnaaactcacttaatatctcatact |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
1189548 |
aatacaggggtcacttttattcccatggattgatacgatatttttaatggataatagagtatcaatattttttttttaaactctcttaatatctcatact |
1189647 |
T |
 |
| Q |
112 |
gaaaaagggttattcaggagttatctacaaaa |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1189648 |
gaaaaagggttattcaggagttatctacaaaa |
1189679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 170 - 319
Target Start/End: Original strand, 1189709 - 1189860
Alignment:
| Q |
170 |
ctaccatttgatagttattttccgaattttatgagggactgggagacatcaatgatactt--nnnnnnnntgtttattttcaattagttattgcttttcc |
267 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
1189709 |
ctaccttttgatagttattttccgatttttatgcgggactgggagacatcaatgatacttaaaaaaaaactgtttattctcaattagctattgcttttcc |
1189808 |
T |
 |
| Q |
268 |
attctatttgtttttcacgtgccatannnnnnnncttacgaaataccctttg |
319 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1189809 |
attctatttgtttttcacgtgccatattttttttcttacgaaataccctttg |
1189860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University