View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3600_high_2 (Length: 311)
Name: NF3600_high_2
Description: NF3600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3600_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 30 - 269
Target Start/End: Complemental strand, 37140835 - 37140596
Alignment:
| Q |
30 |
aatgagttatgtgctccaacactttcagtgataacagaggaagtccctaaagcattgtgaaatctatctgccatcgtctgcattttctttaccgggaaag |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37140835 |
aatgagttatgtgctccaacactttcagtaataacagaggaagtccctaaagcattgtgaaatctatctgccatcgtctgcattttctttcccgggaaag |
37140736 |
T |
|
| Q |
130 |
taattctcatgtgttgatcagtttcctgtacaagtaaacagaattaaacccagatatgacaatagactaataagtgtataagagtaaccatagaacagta |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37140735 |
taattctcatgtgttgatcagtttcctgtacaagtaaacagaattaaagccagatatgacaatagactaataagtgtataagagtaaccatagaacagta |
37140636 |
T |
|
| Q |
230 |
atacctcattgtcacttgatgatccgctatccacaggttc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37140635 |
atacctcattgtcacttgatgatccgctatccacaggttc |
37140596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University