View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3601_high_13 (Length: 314)
Name: NF3601_high_13
Description: NF3601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3601_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 94 - 297
Target Start/End: Complemental strand, 7995119 - 7994915
Alignment:
| Q |
94 |
tgcaaaacgacataggacacaccataattgccaccggcatgcgttggattctttgaatatttgaaattcataatctagtttagcaaaattgcttgaagcg |
193 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7995119 |
tgcaaatcgacaaaggacacaccataattgccaccggcatgccttggattctttgaatatttgaaattcataatctagtttagcaaaattgcttgaagcg |
7995020 |
T |
|
| Q |
194 |
-nnnnnnnnnncagaaaatgatataaaatcattgcatgaatataatatgtcactagaaccatgtaaatcacaatataagaggattaacgtgttagtagtg |
292 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||| |||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7995019 |
aaaaaaaaaaacagaaaatgatataaaatcattgcaatgatataatttgtcactagaactatgttaatcacaatataagaggattaacatgttagtagtg |
7994920 |
T |
|
| Q |
293 |
acaaa |
297 |
Q |
| |
|
||||| |
|
|
| T |
7994919 |
acaaa |
7994915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 12 - 66
Target Start/End: Complemental strand, 7995170 - 7995116
Alignment:
| Q |
12 |
aagaagcatgaagtttctaatcgttttgctagttgtgtgcattgtgctggttgca |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7995170 |
aagaagcatgaagtttctaatcgttttgctagttgtgtgcattgtgctggttgca |
7995116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University