View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3601_high_16 (Length: 269)
Name: NF3601_high_16
Description: NF3601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3601_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 35646540 - 35646298
Alignment:
| Q |
18 |
atatctagaggaggataggcattgccagataagatcaatgaaaggcataggaaagccaagatcctcaaggatatctttcaaaaagctctaatcttaat-- |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35646540 |
atatctagaggaggataggcattgccagataagatcaatgaaaggcataggaaagccaagttcctcaaggatatctttcaaaaagctctaatcttaatga |
35646441 |
T |
 |
| Q |
116 |
----aagttttttcattaagatcatgaattgtaactgagtttgcacacacctgacaaatcttcctagctacatagagatgggccaattatgttccattgt |
211 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35646440 |
tcataagctttttcattaagatcatgaattgtaactgagtttgcacacacctgacaaatcttcctagctacacagagatgggccaattatgttccattgt |
35646341 |
T |
 |
| Q |
212 |
ttctggtagaaaactaaattgaaccgagtcatggaaacttcat |
254 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35646340 |
ttcttgtagaaaactaaattgaaccgagtcatggaaacttcat |
35646298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University