View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3601_high_17 (Length: 256)
Name: NF3601_high_17
Description: NF3601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3601_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 216
Target Start/End: Original strand, 34292180 - 34292397
Alignment:
| Q |
18 |
atctgatctgatttgtatcagaaaagccaagttaggtttgttttatgaccaataatgtgattctgatacacccgcgcatgcttcatttttaacttaccaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34292180 |
atctgatctgatttgtatcagaaaagccaagttaggtttgttttatgaccaataatgtgattctgatacacccgcgcatgcttcatttttaacttaccaa |
34292279 |
T |
 |
| Q |
118 |
ctgccctttttcttttaaaatttgtgcttgatggtagctagtaatattg--------------------ttattgaccttaaagtgtagtagcatttaga |
197 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34292280 |
ctaccctttttcttttaaaatttgtgcttgatggtagctagt-atattgttaatggttccccttcaattttattgaccttaaagtgtagtagcatttaga |
34292378 |
T |
 |
| Q |
198 |
ggaaaaggaatatattttc |
216 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34292379 |
ggaaaaggaatatattttc |
34292397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University