View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3601_low_14 (Length: 292)
Name: NF3601_low_14
Description: NF3601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3601_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 12 - 276
Target Start/End: Complemental strand, 31876372 - 31876108
Alignment:
| Q |
12 |
catcatattcagtgccatcttctccgatgatacactcgaggaaaggtgaaaatgaagatctttacgatgttactagctctagtgtgtgttttggtaatgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31876372 |
catcatattcagtgccatcttctccgatgatacactcgaggaaaggtgaaaatgaagatctttacgatgttactagctctagtgtgtgttttggtaatgt |
31876273 |
T |
 |
| Q |
112 |
aagatcaagagggagttattcttccatgttcaagaaggtattgcttggagattttatgtgatgtttagatcaaggtacttttctctatggttatggttaa |
211 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31876272 |
aagatcaagagggagttattcatccatgttcaagaaggtattgcttggagattttatgtgatgtttagatcatggtacttttctctatggttatggttaa |
31876173 |
T |
 |
| Q |
212 |
ggttaactaataataagcgatgctatagctagaattggaaagattgtatatgccaaacttatagt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31876172 |
ggttaactaataataagcgatgctatagctagaattggaaagattgtatatgccaaacttatagt |
31876108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University