View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3601_low_15 (Length: 285)
Name: NF3601_low_15
Description: NF3601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3601_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 35374795 - 35374528
Alignment:
| Q |
1 |
taccaatgtcattattgtcttcaaactcatccaagcaaataacacaatcacgtagagattcttcgtttgcatacttagcagtgtagacagagaaggggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35374795 |
taccaatgtcattattgtcttcaaactcatccaagcaaataacacaatcacgtagagattcttcgtttgcatacttagcagtgtagacagagaaggggat |
35374696 |
T |
 |
| Q |
101 |
ggtgtttatgaccaactcgtctaagttgtggacgacatgtgtttgcaattggtcgttagaatagtgacatgaggtattcgtatcttcgtgccttatcagc |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35374695 |
ggtgtttctgaccaactcgtctaagttgtggacgacatgtgtttgcaattggtcgttagaatagtgacgtgaggtattcgtatcttcgtgccttatcagc |
35374596 |
T |
 |
| Q |
201 |
attgtttgaaggcgagttagaatccagtggataagtagtacgagaaacagcagaaccaatattatgat |
268 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35374595 |
attgtttgaaggctagttagaatccagtggataagtagtacgagaaacagcagaaccaatattatgat |
35374528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 14 - 101
Target Start/End: Complemental strand, 35381036 - 35380949
Alignment:
| Q |
14 |
attgtcttcaaactcatccaagcaaataacacaatcacgtagagattcttcgtttgcatacttagcagtgtagacagagaaggggatg |
101 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||| || ||||||| | |||||| ||||| ||||||| ||| || ||||| |
|
|
| T |
35381036 |
attgtcttcaaattcattcaagcaaataacacaatcacgttgaaattcttcttgtgcatatttagcgttgtagacggaggagaggatg |
35380949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 36 - 159
Target Start/End: Complemental strand, 30811986 - 30811863
Alignment:
| Q |
36 |
caaataacacaatcacgtagagattcttcgtttgcatacttagcagtgtagacagagaaggggatggtgtttatgaccaactcgtctaagttgtggacga |
135 |
Q |
| |
|
||||||||||| | |||| | || |||| |||||||||||||| ||||||| ||||||| |||||| ||||||||||||||||||||||| || |||| |
|
|
| T |
30811986 |
caaataacacagtaacgtgcaaatgcttcttttgcatacttagcggtgtagatggagaaggagatggtatttatgaccaactcgtctaagttatgaacga |
30811887 |
T |
 |
| Q |
136 |
catgtgtttgcaattggtcgttag |
159 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
30811886 |
catgtgtttgcagttggtcgttag |
30811863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University