View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3601_low_19 (Length: 203)
Name: NF3601_low_19
Description: NF3601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3601_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 185
Target Start/End: Original strand, 42306079 - 42306249
Alignment:
| Q |
15 |
gagagaagaaacgaagagtttgaggcaagagattagggtttaaatctatggatccgaaacgggtttgggcttcaatagaaaaggaaaacggcccatcctt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42306079 |
gagagaagaaacgaagagtttgaggcaagagattagggtttaaatctatggatccgaaacgggtttgggcttcaatagaaaaggaaaacggcccatcctt |
42306178 |
T |
 |
| Q |
115 |
tgttaatgattgctaatcgcaccccttatatgctcaaatttgtacgacggtatattttcagatgaaataca |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42306179 |
tgttaatgattgctaatcgcaccccttatatgctcaaatttgtacgacggtatattttcagatgaaataca |
42306249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 15 - 143
Target Start/End: Complemental strand, 339314 - 339186
Alignment:
| Q |
15 |
gagagaagaaacgaagagtttgaggcaagagattagggtttaaatctatggatccgaaacgggtttgggcttcaatagaaaaggaaaacggcccatcctt |
114 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
339314 |
gagagaagaaacgaagggtttgaggcaagagattagggtttaaatctatggatccgaaacgggtttaagcttcaatagaaaaggaaaacggcccatcctt |
339215 |
T |
 |
| Q |
115 |
tgttaatgattgctaatcgcaccccttat |
143 |
Q |
| |
|
|||| |||||||||||||||||||||||| |
|
|
| T |
339214 |
tgttcatgattgctaatcgcaccccttat |
339186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 138 - 185
Target Start/End: Complemental strand, 336885 - 336838
Alignment:
| Q |
138 |
ccttatatgctcaaatttgtacgacggtatattttcagatgaaataca |
185 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
336885 |
ccttatatgctcaaatttgtacgatggaatattttcagatgaaataca |
336838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University