View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3604_high_16 (Length: 346)
Name: NF3604_high_16
Description: NF3604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3604_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 85 - 341
Target Start/End: Original strand, 185027 - 185283
Alignment:
| Q |
85 |
aggatgactcatatgatgacacctacattagtaccatcggcgttgatttcgtaattaactaactaattcacactctattcttttatatatgtttcgtacg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
185027 |
aggatgactcatatgatgacacctacattagtaccatcggcgttgatttcgtaattaactaactaattcacactctattcttttctatatgtttcgtacg |
185126 |
T |
|
| Q |
185 |
ctatgctattttgattttgactttgatggcagaaaatcagaactgttgaacttgaaggcaaaaccgccaagctgcagattgttagttctcttttctcatt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
185127 |
ctatgctattttgattttgactttgatggcagaaaatcagaactgttgaacttgaaggcaaaaccgccaagctgcagattgttagttctcttttctcatt |
185226 |
T |
|
| Q |
285 |
acttttttaatcataatcataattaattacttaattactactttgtttagtgggata |
341 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
185227 |
acttttttaatcataatcataagtaattacttaattactactttgtttagtgggata |
185283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University