View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3604_low_14 (Length: 375)
Name: NF3604_low_14
Description: NF3604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3604_low_14 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 6 - 375
Target Start/End: Complemental strand, 14539432 - 14539063
Alignment:
| Q |
6 |
aggagcagagaacccatgcaatggatccagtccctagatcagggattggatcatgcatggttggcggccatacacctgtgggttcctgcagtgctgtcgt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
14539432 |
aggagcagagaacccatgcaatggatccagtccctagatcagggattggatcatgcatggttggcggccatacacccgtgggatcctgcagtgctgtcgt |
14539333 |
T |
 |
| Q |
106 |
ggccgcaacgcaggacgaaggaggtatccttgctgcgtcagcggcaaagcatgggagggtggcacacgtggcggggagcggtagggaccaaagtatgagt |
205 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14539332 |
ggccgcaacgcaagacgaaggaggtatccttgctgcgtcagcggcaaagcgtgggagggtggcacacgtggcggggagcggtagggaccaaagtatgagt |
14539233 |
T |
 |
| Q |
206 |
ggcagtgcaacctttgggaggcagagccaacaagtgacacttgatacgtacgatagggaatttggtatgactggtttcacttcaacttcaatagcttcta |
305 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14539232 |
ggcagtgcaacctttgggaggcagagccagcaagtgacacttgatacgtacgatagggaatttggtatgactggtttcacttcaacttcaatagcttcta |
14539133 |
T |
 |
| Q |
306 |
tggataacaccagctctgagaagcagtgcaccaggaccaccaccatagacgaccatgattctgtttgtca |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14539132 |
tggataacaccagctctgagaagcagtgcaccaggaccaccaccatagacgaccatgattctgtttgtca |
14539063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University