View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3604_low_20 (Length: 265)
Name: NF3604_low_20
Description: NF3604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3604_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 18 - 138
Target Start/End: Complemental strand, 14539086 - 14538966
Alignment:
| Q |
18 |
agacgaccatgattctgtttgtcacagtagaccaccggtaagattctcactcacttgtataaatgttactttgtgtgtatgattatgaatgttcattgat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
14539086 |
agacgaccatgattctgtttgtcacagtagaccaccggtaagattctcactcacttgtataaatggtactttgtgtgtatgattatgaatgatcattgat |
14538987 |
T |
 |
| Q |
118 |
tggttttatatataaagtgat |
138 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
14538986 |
tggttttatatataaagtgat |
14538966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 161 - 247
Target Start/End: Complemental strand, 14538903 - 14538817
Alignment:
| Q |
161 |
tatattttgtataaatctctatgcaccaagagtataaatcttactatgttttgtgttaatttgtaaaaagattttacaatatatatg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14538903 |
tatattttgtataaatctctatgcaccaacgctataaatcttactatgtattgtgttaatttttaaaaagattttacaatatatatg |
14538817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University