View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3604_low_21 (Length: 253)
Name: NF3604_low_21
Description: NF3604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3604_low_21 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 6 - 253
Target Start/End: Original strand, 45345107 - 45345354
Alignment:
| Q |
6 |
gtcgaagaatatcctgtctcagtgataagttttctctatctgaaacagttttttggttttgatcacctccattatcaaaatgacaaccacttaaaaccaa |
105 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45345107 |
gtcgaacaatatcctgtctcagtgataagttttctcgatctgaaacagttttttggttttgatcacctccattatcaaaatgacagccacttaaaaccaa |
45345206 |
T |
|
| Q |
106 |
attttcatccctttgtttaccattacctgctacttctctgaaccttgattctactctgagattattcaggattccttgagttctttcttgtggcaaagac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45345207 |
attttcatccctttgtttaccattacctgctacttctctgaaccttgattctactctgagattattcaggattccttgagttctttcttgtggcaaagac |
45345306 |
T |
|
| Q |
206 |
agcacactgcttggtggcatccatgacttttcctgtctttctgtttgc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45345307 |
agcacactgcttggtggcatccatgacttttcctgtctttctgtttgc |
45345354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University