View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3604_low_26 (Length: 249)
Name: NF3604_low_26
Description: NF3604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3604_low_26 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 8 - 249
Target Start/End: Complemental strand, 30603937 - 30603694
Alignment:
| Q |
8 |
agcacagagcataaaaaatgattgagtgggtgaaattatcagcattgattttatgctcttccatggcatgcaataacttcattacttcatctaccttatt |
107 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||| |
|
|
| T |
30603937 |
agcacaaagcataaaaaatgattgagttggtgaaattatcagcattgattttatgctcttccatggtaggtaataacttcattacttcatctaccttatt |
30603838 |
T |
 |
| Q |
108 |
catttga-gtaaagcacaacacaagcagttgtaagtcactatatcaggttgcaagcctctgttttgcatatgatggaacatggaccaagcagagcttaaa |
206 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30603837 |
catttgaagtaaagcacaacacaagtagttgtaagtcactatatcaggttgcaggcctctgttttgcatatgatggaacatggaccaagcagagcttaaa |
30603738 |
T |
 |
| Q |
207 |
tatcctcatttgc-aaaagaatctatcaaatagttacacgaaac |
249 |
Q |
| |
|
|||||| |||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
30603737 |
tatcctgatttgcaaaaagaatttatcaaatagttacacgaaac |
30603694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University