View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3604_low_29 (Length: 237)
Name: NF3604_low_29
Description: NF3604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3604_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 14176884 - 14177105
Alignment:
| Q |
1 |
attattaatctttttctttagaagaccttatatattgttaatgtaagttgtatgatgtgttgcatatatctacatagagatgttccatatgcatttatgt |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14176884 |
attattaatctttttcttcagaagaccttatatattgttaatgtaagttgtatgatgtgttgcatatatctacttagagatgttccatatgcatttatgt |
14176983 |
T |
 |
| Q |
101 |
atgtggtgacaagtaaaatcttataccnnnnnnnnnaacataaataaaaaagaagtagcatttgcatggtgaaaatgaaaactacatttgctagacgaaa |
200 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14176984 |
atgtggtaacaagtaaaatcttatac--ttttttttaacataaataaaaaagaagtagcatttgcatggtgaaaatgaaaactacatttgctagacgaaa |
14177081 |
T |
 |
| Q |
201 |
acatatatatttcaccaacttatt |
224 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
14177082 |
acatatatatttcaccaatttatt |
14177105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University