View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3604_low_32 (Length: 235)
Name: NF3604_low_32
Description: NF3604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3604_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 32450506 - 32450322
Alignment:
| Q |
1 |
aagtttgttgaaatcccgatatctcaccatgattcattcaaactcaccgtgatcccatgcacaaagttaccaatcaaattaattcccatattttgaagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32450506 |
aagtttgttgaaatcccgatatctcaccatgactcattcgaactcaccgtgatcccatgcactaagttaccaatcaaattaattcccatattttgaagtt |
32450407 |
T |
 |
| Q |
101 |
gaattggtttaacaaatcaaagggattccaaaatcaaataaactccaatttcaaaactattgaaacaaacaactttacttacaaa |
185 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32450406 |
gaattggtttttcaaatcaaagtgattccaaaatcaaataaactccaatttcaaaactattgaaacaaacaactttacttccaaa |
32450322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 96 - 138
Target Start/End: Complemental strand, 32450636 - 32450594
Alignment:
| Q |
96 |
aagttgaattggtttaacaaatcaaagggattccaaaatcaaa |
138 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
32450636 |
aagttgaattggttttacagatcaaagggattccaaaatcaaa |
32450594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University