View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3605_high_14 (Length: 476)
Name: NF3605_high_14
Description: NF3605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3605_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 3e-77; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 314 - 468
Target Start/End: Original strand, 38997307 - 38997461
Alignment:
| Q |
314 |
cacccgttgaattttgtgtgtatgatgataactgttgactataagcctttcttatcttcataaaaaatattcggaataattatattcaatcaaaactaaa |
413 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38997307 |
cacccattgaattttgtgtgtatgatgataactgttgactataagcctttcttatcttcataaaaaatattcggaataattatattcaatcaaaactaaa |
38997406 |
T |
|
| Q |
414 |
aatttgaatccatatcttgatgctaattttacaggtatcttgcaatgttctctgc |
468 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38997407 |
aatttgaatccatatctcgatgctaattttacaggtatcttgcaatgttctctgc |
38997461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 38997115 - 38997274
Alignment:
| Q |
1 |
atgtctatctttagtttttgcctctgtttatgcctttagttgtgaagttatgtttcggttcaatctggtttagtgatacaatcttttttgtagacgccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
38997115 |
atgtctatctttagtttttgcctctgcttatgcctttagttgtgaagttatgtttcggttcaatttggtt--gtgatacaatcttttttgtagacgccaa |
38997212 |
T |
|
| Q |
101 |
gatatacgactgagttacttagattcagtcatacggatcaaccggtgatccaacaatctctt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38997213 |
gatatacgactgagttacttagattcagtcatacggatcaaccggtgatccaacaatctctt |
38997274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 413 - 468
Target Start/End: Original strand, 39001566 - 39001621
Alignment:
| Q |
413 |
aaatttgaatccatatcttgatgctaattttacaggtatcttgcaatgttctctgc |
468 |
Q |
| |
|
|||| ||||| ||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
39001566 |
aaatatgaattcatatcttgatgctagttttacagatatcttgcaatgttctctgc |
39001621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University