View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3605_high_27 (Length: 387)
Name: NF3605_high_27
Description: NF3605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3605_high_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 24 - 381
Target Start/End: Original strand, 26734096 - 26734453
Alignment:
| Q |
24 |
atggtgttggaacccaggagattttttacgacggtaaaggcaataaggtggaaggagagacgtaaatgcggtgtaaaagtttatgtgttggatgctgaan |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26734096 |
atggtgttggaacccaggagattttttacgacggtaaaggcaataaggtggaaggagagacgtaaatgaggtgtaaaagtttatgtgttggatgctggtt |
26734195 |
T |
|
| Q |
124 |
nnnnnnnnnnnaattgggggtggggtggcagtggccaaacggctctatcattctctgggttttcttgtctttgtatttgacactgttgtggtgtttttac |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26734196 |
ttttatttttcaattgggggtggggtggcagtggccaaacggctctatcattctctgggttttcttgtctctgtatttgacactgttgtggtgtttttac |
26734295 |
T |
|
| Q |
224 |
attttgtaaaggtgggatgtcgctgtgtaagggataatgttactgtggtggtgattagtatagtgagtaccttttaggttgtttagctgtttatggatgc |
323 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26734296 |
gttttgtaagggtgggatgtcactgtgtaagggataatgttattatggtggtgattagtatagtgagtaccttttaggttgtttagctgtttatggatgc |
26734395 |
T |
|
| Q |
324 |
gcctcctttttggcctctgggtgttttttccaatgttgtattatatagttcttctcac |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26734396 |
gcctcctttttggcctctgggtgttttttccaatgttgtattatatagttcttgtcac |
26734453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University