View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3605_high_35 (Length: 355)

Name: NF3605_high_35
Description: NF3605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3605_high_35
NF3605_high_35
[»] chr1 (3 HSPs)
chr1 (238-347)||(48268381-48268490)
chr1 (118-175)||(48268261-48268318)
chr1 (18-50)||(48268161-48268193)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 238 - 347
Target Start/End: Original strand, 48268381 - 48268490
Alignment:
238 tgaggtggagtcagatttgtgtctctggttttagaattgtttagtgttactactctgttggctatgttccctgagctgactcggtgcgcccggactccgt 337  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48268381 tgaggtggagtcagatttgtgtctctggttttagaattgtttagtgttactactctgttggctatgttccctgagctgactcggtgcgcccggactccgt 48268480  T
338 ggcctttgct 347  Q
    ||||||||||    
48268481 ggcctttgct 48268490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 118 - 175
Target Start/End: Original strand, 48268261 - 48268318
Alignment:
118 cacatgttggatttggaacttgaagcttgtaaaagtgttggtggtatggtatgaatct 175  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
48268261 cacatgttggatttggaacttgaagcttttaaaagtgttggtggtatggtatgaatct 48268318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 48268161 - 48268193
Alignment:
18 gttttcagttgcaggttttcaaacttcaacggt 50  Q
    |||||||||||||||||||||||||||||||||    
48268161 gttttcagttgcaggttttcaaacttcaacggt 48268193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University