View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3605_high_35 (Length: 355)
Name: NF3605_high_35
Description: NF3605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3605_high_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 238 - 347
Target Start/End: Original strand, 48268381 - 48268490
Alignment:
| Q |
238 |
tgaggtggagtcagatttgtgtctctggttttagaattgtttagtgttactactctgttggctatgttccctgagctgactcggtgcgcccggactccgt |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48268381 |
tgaggtggagtcagatttgtgtctctggttttagaattgtttagtgttactactctgttggctatgttccctgagctgactcggtgcgcccggactccgt |
48268480 |
T |
|
| Q |
338 |
ggcctttgct |
347 |
Q |
| |
|
|||||||||| |
|
|
| T |
48268481 |
ggcctttgct |
48268490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 118 - 175
Target Start/End: Original strand, 48268261 - 48268318
Alignment:
| Q |
118 |
cacatgttggatttggaacttgaagcttgtaaaagtgttggtggtatggtatgaatct |
175 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48268261 |
cacatgttggatttggaacttgaagcttttaaaagtgttggtggtatggtatgaatct |
48268318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 48268161 - 48268193
Alignment:
| Q |
18 |
gttttcagttgcaggttttcaaacttcaacggt |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48268161 |
gttttcagttgcaggttttcaaacttcaacggt |
48268193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University