View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3605_high_37 (Length: 343)
Name: NF3605_high_37
Description: NF3605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3605_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 17 - 331
Target Start/End: Complemental strand, 55342086 - 55341772
Alignment:
| Q |
17 |
aatatttctgcttgatgtaaaactttttggacaatggttcactactgaaaagaggtttctatcagtagtagcaaaccctgtcaacctggtttctgttata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55342086 |
aatatttctgcttgatgtaaaactttttggacaatggttcactactgaaaagaggtttctgtcagtagtagcaaaccctgtcaacctggtttctgttata |
55341987 |
T |
|
| Q |
117 |
gggaacttggtggctgctcaagttatgacagaaattggttggaacgagattgcaatttcaatgtattcattaggaatggtacattatttgattctatttg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55341986 |
gggaacttggtggctgctcaagttatgactgaaattggttggaacgagattgcaatttcaatgtattcattaggaatggtacattatttgattctatttg |
55341887 |
T |
|
| Q |
217 |
tgacgctgtatcagcgtctaacaagtagtaatcagtttcctgtagtgctaaggccagcttannnnnnnnnnnnngctgcgccaagcatggcaagtcttgc |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
55341886 |
tgacgctgtatcagcgtctaacaagtagtaatcagtttcctgtagtgctaaggccagcttattttttgttttttgctgcaccaagcatggcaagtcttgc |
55341787 |
T |
|
| Q |
317 |
ttggaaatccatctc |
331 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
55341786 |
ttggaaatccatctc |
55341772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University