View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3605_high_46 (Length: 297)
Name: NF3605_high_46
Description: NF3605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3605_high_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 17 - 279
Target Start/End: Complemental strand, 37091323 - 37091060
Alignment:
| Q |
17 |
aatatgaagttatgttacaaaccaaacacctacaagaaataaacaatgaaacgc-tagctaggaagcaaaacatggttctagcaaggtaacaaggttcaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37091323 |
aatatgaagttatgttacaaaccaaacaactacaagaaataaacaatgaaacacctagctaggaagcaaaacatggttctagcaaggtaacaaggttcaa |
37091224 |
T |
 |
| Q |
116 |
acatcagaagaagggatttatccatcactgatgaaaatcaaagttaagtgtttgtgtttggatttcaaccaccacaaaatagaagtttcactttatcaca |
215 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37091223 |
acttcagaagaagggatttatccatcactgatgaaaatcaaagttaagtgtttgtgtttggatttcaaccaccacaaaatagaagtttcactttatcaca |
37091124 |
T |
 |
| Q |
216 |
tatatgatgtaagggcaactgattttgctgaaaaatgctacaattcctttctttttagagaaca |
279 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37091123 |
tagatgatgtaagggcaactgattttgctgaaaaatgctacaattcctttctttttagagaaca |
37091060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University