View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3605_high_52 (Length: 278)
Name: NF3605_high_52
Description: NF3605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3605_high_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 80 - 172
Target Start/End: Original strand, 2463487 - 2463579
Alignment:
| Q |
80 |
ttggtttgaatctttgtcaatcttatgctctttttgctgagcttatgggagtgattcttgcaattgagttcgcttattaaggaaacatgaatt |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2463487 |
ttggtttgaatctttgtcaatcttatgctctttttgctgagcttatgggagtgattcttgcaattgagttcgcttattaaggaaacatgaatt |
2463579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 2463376 - 2463453
Alignment:
| Q |
1 |
gtcatatgacaacctcctttgtttaactggatcaaatctaatacagatgacacatcgttaggttctcttggcccttct |
78 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2463376 |
gtcatacgacaacctcctttgtttaactggatcaaatctaatacagatgacacatccttaggttctcttggcccttct |
2463453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 166 - 228
Target Start/End: Original strand, 2463970 - 2464032
Alignment:
| Q |
166 |
atgaattgcggtagaaaagaggcaatgggattaagacgtctgagtatttgtgtccatcttttg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
2463970 |
atgaattgcggtagaaaagaggcaatgggattaagacgtctgaatatttgtgtccaacttttg |
2464032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University