View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3605_low_27 (Length: 388)
Name: NF3605_low_27
Description: NF3605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3605_low_27 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 69 - 388
Target Start/End: Complemental strand, 30715828 - 30715509
Alignment:
| Q |
69 |
cttgtaaaaacgacaacttgatttcatcccatgaaagagaaatgtaataaggctcgatgttgaggtcgtaccatagtgcagattcttcttcaagtgtgac |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715828 |
cttgtaaaaacgacaacttgatttcatcccatgaaagagaaatgtaataaggctcgatgttgaggtcgtaccatagtgcagattcttcttcaagtgtgac |
30715729 |
T |
 |
| Q |
169 |
agggaagatcttcttttgcatttcaacggaggatgcattgtttgctctacatactttgttgaaacgactcaaatgggttattggggattcgtttggagtg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715728 |
agggaagatcttcttttgcatttcaacggaggatgcattgtttgctctacatactttgttgaaacgactcaaatgggttattggggattcgtttggagtg |
30715629 |
T |
 |
| Q |
269 |
ccatgaaaaattggtaaaggagcgattggtatgtatgaagatgcattcatgggttgtgtgggatttgggacattataagaagaaactgaagggctttctg |
368 |
Q |
| |
|
||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30715628 |
ccacgaaaaattggtaaaggagcgatttgtatgtatgaagatgcattcatgggttgtgtgggatttcggacattataagaagaaactgaagggctttctg |
30715529 |
T |
 |
| Q |
369 |
gaacattgccaatgtgtgct |
388 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30715528 |
gaacattgccaatgtgtgct |
30715509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University