View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3605_low_34 (Length: 359)
Name: NF3605_low_34
Description: NF3605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3605_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 16 - 352
Target Start/End: Original strand, 27934008 - 27934344
Alignment:
| Q |
16 |
ctttgattactaggatttctaataagaattttgaaacatcaaggtgaatataatctataaatatatattggaatattattgaattgaaattaaagtccaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27934008 |
ctttgattactaggatttctaataagaattttgaaacatcaaggtgaatataatctataaatatatattggaatattattgaattgaaattaaagtccaa |
27934107 |
T |
|
| Q |
116 |
tcttagcatcacagttgaaaaactctgcctacattctatgaagggttgcaaaggatccaccaaatcatattctcaaaagttggactatgaaaaaattaca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27934108 |
tcttagcatcacagttgaaaaactctgcctacattctatgaagggttgcaaaggatccaccaaatcatattctcaaaagttggactatgaaaaaattaca |
27934207 |
T |
|
| Q |
216 |
ccttccaacatcacaatacaatgtccctgcgatggcactatactgatagtacaaacccctaagatgaaaaacacaacatctcaatactgctattattgga |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27934208 |
ccttccaacatcacaatacaatgtccctgcgatggcactatactgatagtacaaacccctaagatgaaaaacacaacatcccaatactgctattattgga |
27934307 |
T |
|
| Q |
316 |
cccttcatttgttctatgctccctagctctgcctatg |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27934308 |
cccttcatttgttctatgctccctagctctgtctatg |
27934344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University