View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3605_low_36 (Length: 356)
Name: NF3605_low_36
Description: NF3605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3605_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 15 - 346
Target Start/End: Complemental strand, 9643776 - 9643445
Alignment:
| Q |
15 |
aaaagcatcattaatggaaattggagtatcattacctcagttctatacatcttaatctcgtcttcaagaggcgtgatgacactttcaaatggataaaaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9643776 |
aaaagcatcattaatggaaattggagtatcattacctcagttctatacatcttaatctcgtcttcaagaggcgtgatgacactttcaaatggataaaaat |
9643677 |
T |
 |
| Q |
115 |
cttcttccttttgatctgtgtgtaatcttctaagtgctgattctgcagcatattgtgcagccaacgcatctttcttttcgtccgtcagtttcttgatttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9643676 |
cttcttccttttgatctgtgtgtaatcttctaagtgctgattctgcagcatattgtgcagccaacgcatctttcttttcgtccgtcagtttcttgatttc |
9643577 |
T |
 |
| Q |
215 |
taggttctgcatatgaagatattttgaataacatgcatcatagaatttatcattgttttggatacaatagtaccttgtttttaagatgatcctctttaag |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9643576 |
taggttctgcatatgaagatattttgaataacatgcatcatagaatttatcattgttttggatacaatagtaccttgtttttaagatgatcctctttaag |
9643477 |
T |
 |
| Q |
315 |
tcttagtctctcatccatcttactgacttcat |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9643476 |
tcttagtctctcatccatcttactgacttcat |
9643445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 141 - 227
Target Start/End: Complemental strand, 56006479 - 56006393
Alignment:
| Q |
141 |
cttctaagtgctgattctgcagcatattgtgcagccaacgcatctttcttttcgtccgtcagtttcttgatttctaggttctgcata |
227 |
Q |
| |
|
|||||||||| || |||||| |||||||||||||||| ||| |||||||| ||| ||||||||||||||| ||| ||||||||| |
|
|
| T |
56006479 |
cttctaagtgttgcttctgcggcatattgtgcagccattgcacttttctttttgtctgtcagtttcttgattcctatattctgcata |
56006393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University