View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3605_low_38 (Length: 353)
Name: NF3605_low_38
Description: NF3605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3605_low_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 13 - 340
Target Start/End: Complemental strand, 10336392 - 10336065
Alignment:
| Q |
13 |
aatatggacctcgaaacaaccaaaatgctaaaaaactccggccatccaccggcgccggagtcatcatcttccttctccgacaagttctaccaaatccgcg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10336392 |
aatatggacctcgaaacaaccaaaatgctaaaaaactccggccatccaccgtcgccggagtcatcatcttccttctccgacaagttctaccaaatccgcg |
10336293 |
T |
 |
| Q |
113 |
gcgcatttctaatgctggcacttcctctactcctcgtcacactcatactctacatcatgccttccacttcttcaaatgaatccatcgaagattacgctct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || || |||||||||||||| ||||| |
|
|
| T |
10336292 |
gcgcatttctaatgctggcacttcctctactcctcgtcacactcatactctatatcatgccttccacttcttcgaacgagtccatcgaagattatgctct |
10336193 |
T |
 |
| Q |
213 |
cacgcatcggaagatttctcctgatcggaaaatttctgattcgtttgctgttgtttttgatgctggaagttctggtagtcgtgttcatgtttttcggttt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10336192 |
cacgcatcggaagatttctcctgatcggaaaatttctgattcgtttgctgttgtttttgatgctggaagttctggtagtcgtgttcatgtttttcggttt |
10336093 |
T |
 |
| Q |
313 |
gatcggaatcttgagcttgtgaaaattg |
340 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
10336092 |
gatcggaatcttgagcttgtgaaaattg |
10336065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 258 - 321
Target Start/End: Original strand, 32897455 - 32897518
Alignment:
| Q |
258 |
tgctgttgtttttgatgctggaagttctggtagtcgtgttcatgtttttcggtttgatcggaat |
321 |
Q |
| |
|
||||||| ||||||||||||| || |||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
32897455 |
tgctgttatttttgatgctggtagctctggtagccgtgttcatgtttttcattttgatcagaat |
32897518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University