View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3605_low_55 (Length: 268)
Name: NF3605_low_55
Description: NF3605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3605_low_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 108 - 250
Target Start/End: Complemental strand, 4508484 - 4508346
Alignment:
| Q |
108 |
gattttattgaataatactaacaagtgtctttgaaattttgttttaattagaaaagttcaatttcttaaaagttcaaaattcattttttaatagaaaatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4508484 |
gattttattgaataatactaacaagtgtctttgaaattttgttttaattagaaaagttcaatttcttaaaagttcaaaattcattttttaatagaaaatt |
4508385 |
T |
 |
| Q |
208 |
gatagtttttcttcaatatataactagctagtgtccaaattaa |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4508384 |
gatagtttttcttca----ataactagctagtgtccaaattaa |
4508346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 2 - 71
Target Start/End: Complemental strand, 4513173 - 4513104
Alignment:
| Q |
2 |
aagcaaaatcgaaaggatgaaaatgtgacataaatgagtctcttttgctttccgacatgcaaaaccacct |
71 |
Q |
| |
|
|||| ||| |||||||||||||||||||||| ||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
4513173 |
aagcgaaagcgaaaggatgaaaatgtgacatgaatgagtctctttcgctttccgacatgccaaaccacct |
4513104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University