View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3605_low_69 (Length: 246)
Name: NF3605_low_69
Description: NF3605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3605_low_69 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 71 - 246
Target Start/End: Complemental strand, 38042024 - 38041849
Alignment:
| Q |
71 |
gataattagtatgactaattaaattataaattaatgtcttttattaaacacatgttgatagatgcttatgtatctcactcatatttatagttttgaagaa |
170 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38042024 |
gataatcagtatgattaattaaattataaattaatgtcttttattaaacacatgttgatagatgcttatgtatctcactcatatttatagttttgaagaa |
38041925 |
T |
|
| Q |
171 |
attaaagtacaatactaggaatagatttatttatttttggtatgatcatcgatgttgcgttattgtgttttaagtt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
38041924 |
attaaagtacaatactaggaatagatttatttatttttggtatgatcatcgatgttgcattattgtcttttaagtt |
38041849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 18 - 79
Target Start/End: Complemental strand, 38042234 - 38042173
Alignment:
| Q |
18 |
aatgagaaggtgcatgtgcatgtgtaatttaaaaatatgtaagcttcgtgatagataattag |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
38042234 |
aatgagaaggtgcatgtgcatgtgtaatttaaaaatatgcaaggttcgtgatagataattag |
38042173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University