View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3606_high_19 (Length: 321)
Name: NF3606_high_19
Description: NF3606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3606_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 10 - 305
Target Start/End: Complemental strand, 1610958 - 1610663
Alignment:
| Q |
10 |
aagaatatatagatatggattccgttacaagtgaggggagcttcatcttacagggtgaaggattaaattatgttggtgcaagaggttcggatcgattgag |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1610958 |
aagaaaatatagatatggattccgttacaagtgaggggagcttcatcttacagggtgaaggattaatttatgttggtgcaagaggttcggatcgattgag |
1610859 |
T |
|
| Q |
110 |
gtttcaaaatgccgcgcgtgaatttggctttgctaagtatccacataggctagaactagacattcaacagcaggttgtgggagcatgtgaaaatcctaga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1610858 |
gtttcaaaatgccgcgcgtgaatttggctttgctaagtatccacataggccagaactagacattcaacagcaggttgtgggagcatgtgaaaatcctaga |
1610759 |
T |
|
| Q |
210 |
agttctaggactggttcaccattcactatgcaacctaagtataattccctgatggaagctcgagggtgcatatatttaatggccaaagatcaaaat |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1610758 |
agttctaggactggttcaccattcactatgcaacctaagtataattccctgatggaagctcgagggtgcatatatttaatggccaaagatcaaaat |
1610663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University